View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5418_low_110 (Length: 238)
Name: NF5418_low_110
Description: NF5418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5418_low_110 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 5 - 222
Target Start/End: Original strand, 10157362 - 10157579
Alignment:
| Q |
5 |
atggtgatgatgttgacccccaagtaacgtatatgttccaagtttttgattttgtgacttgcagaaaaagtaaactatttaaggtgaagattgcaattta |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10157362 |
atggtgatgatgttgacccccaagtaacgtatctgttccaagtttttgattttgtgacttgcagaaaaagtaaactatttaaggtgaagattgcaattta |
10157461 |
T |
|
| Q |
105 |
aggagaagagtatttcaatatactaaaatggaagatcgtgactccctaacaatgaacatagtcaatacttgatataatattatgctctcttcacgaatac |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
10157462 |
aggagaagagtatttcaatatactaaaatggaagatcgtgactccctaacaattaacatagtcaatacttgatataatattatgctctcttcacgaacac |
10157561 |
T |
|
| Q |
205 |
accctccattcatgtaac |
222 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
10157562 |
accctccattcatgtaac |
10157579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University