View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5418_low_115 (Length: 217)
Name: NF5418_low_115
Description: NF5418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5418_low_115 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 13 - 199
Target Start/End: Original strand, 43206772 - 43206958
Alignment:
| Q |
13 |
agcagagaccagccgttaatgcgttggcattgaacagtgatggaacggtgttgttttcaggtgggagtgacgggacgatttgtcagtggcaggataaaca |
112 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43206772 |
agcagaaaccagccgttaatgcgttggcattgaacagtgatggaacggtgttgttttcaggtgggagtgacgggacgatttgtcagtggcaggataaaca |
43206871 |
T |
|
| Q |
113 |
aaacgacatcgtgttgaaggaaaagttgaggggtcatagtggggcaatactttgtttagtcaacgttgatgatttgttggtgagtgg |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
43206872 |
aaacgacatcgtgttgaaggaaaagttgaggggtcatagtggggcaatactttgtttagtcaacgttgatgatttgttggcgagtgg |
43206958 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University