View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5418_low_116 (Length: 215)
Name: NF5418_low_116
Description: NF5418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5418_low_116 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 21 - 195
Target Start/End: Complemental strand, 3073216 - 3073042
Alignment:
| Q |
21 |
tctcagtaaaataaatnnnnnnncatatatactaaccttgtaataagactatacacnnnnnnn-ttccactaggaactgataattatgattttttatgcc |
119 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||||||||||||| |||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
3073216 |
tctcagtaaaataaataaaaaaacaaatatactaaccttgtaataagactacacacaaaaaaaattccactagggactgataattatgattttttatgcc |
3073117 |
T |
|
| Q |
120 |
atgattaatctctctcttttcttaaaacttttaaaattttatcgtgaagattcttacgatgttctagccatgacta |
195 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3073116 |
atgattaatctctctcttttcttaaaac-tttaaaattttatcgtgaagattcttacgatgttctagccatgacta |
3073042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University