View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5418_low_119 (Length: 201)
Name: NF5418_low_119
Description: NF5418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5418_low_119 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 162; Significance: 1e-86; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 18 - 187
Target Start/End: Complemental strand, 7631271 - 7631102
Alignment:
| Q |
18 |
acttaggcctggtggcatgcttgtacaaaaaagagagggtaacaaaagtgttggggagataatcacaattagagtctcaactatgtcaaagtggcatgac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7631271 |
acttaggcctggtggcatgcttgtacaaaaaagagagggtaacaaaagtgttggggagataatcacaattagagtctcaactatgtcaaagtggcatgac |
7631172 |
T |
|
| Q |
118 |
atttctattgaagaaacttcaacttttggtaagtctaatctaacctttcatttgtattcattgccctttg |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
7631171 |
atttctattgaagaaacttcaacttttggtaagtctaatccaacctttcatttgtattcattgccttttg |
7631102 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 18 - 157
Target Start/End: Complemental strand, 7642195 - 7642059
Alignment:
| Q |
18 |
acttaggcctggtggcatgcttgtacaaaaaagagagggtaacaaaagtgttggggagataatcacaattagagtctcaactatgtcaaagtggcatgac |
117 |
Q |
| |
|
|||||| || |||||||||||||| || ||||||||| | || ||||||| |||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
7642195 |
acttagacccggtggcatgcttgtgcagaaaagagagagcaagaaaagtga---ggagataatcacaattagagtctcaactttgtcaaagtggcatgac |
7642099 |
T |
|
| Q |
118 |
atttctattgaagaaacttcaacttttggtaagtctaatc |
157 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
7642098 |
atttctattgaagccacttccacttttggtaagtctaatc |
7642059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University