View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5418_low_52 (Length: 362)
Name: NF5418_low_52
Description: NF5418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5418_low_52 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 321; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 321; E-Value: 0
Query Start/End: Original strand, 12 - 344
Target Start/End: Complemental strand, 35658158 - 35657826
Alignment:
| Q |
12 |
atgaatagaatcgaactgagctgaaaatctggggtatatacatataatcagcgggaaaactaacaaacagtataagtttggcaacactgaccgcctttgc |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35658158 |
atgaatagaatcgaactgagctgaaaatctggggtatatacatataatcagcgggaaaattaacaaacagtataagtttggcaacactgaccgcctttgc |
35658059 |
T |
|
| Q |
112 |
aaactcgattctaagcgggttgccagcaagaggaaaaccttgcagcgatctcatagcatcaatggcatcttcatccacttcaaaattgatgaaagcatag |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35658058 |
aaactcgattctaagcgggttgccagcaagaagaaaaccttgcagcgatctcatagcatcaatggcatcttcatccacttcaaaattgatgaaagcatag |
35657959 |
T |
|
| Q |
212 |
cttctcccaggctgaaacgcaactttttccaacggtccaaaccgtataaaaggatgcgcaagctcatcctctacaatactgtgtgataaattcccaaccc |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35657958 |
cttctcccaggctgaaacgcaactttttccaacggtccaaaccgtataaaaggatgcgcaagctcatcctctacaatattgtgtgataaattcccaaccc |
35657859 |
T |
|
| Q |
312 |
aaagatgcctggaaggaggattgctgctgttcc |
344 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
35657858 |
aaagatgcctggaaggaggattgctgctgttcc |
35657826 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University