View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5418_low_58 (Length: 339)
Name: NF5418_low_58
Description: NF5418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5418_low_58 |
 |  |
|
| [»] scaffold0246 (1 HSPs) |
 |  |  |
|
| [»] scaffold0096 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0246 (Bit Score: 291; Significance: 1e-163; HSPs: 1)
Name: scaffold0246
Description:
Target: scaffold0246; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 18 - 328
Target Start/End: Complemental strand, 13580 - 13270
Alignment:
| Q |
18 |
aaaaagttgcattaagaaaaagtatacaaacttattcgaaacatatctcaccaaatttccagagtccacatcagaagctgtcaactgtttctgaatggag |
117 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
13580 |
aaaaagttgcattaacaaaaagtatacaaacttattcaaaacatatctcaccaaatttccagagtccacatcagaagctgtcaactgtttctgaatggtg |
13481 |
T |
 |
| Q |
118 |
tggtaaaatttctttggaagaacaaaaaagcaagagcattaggaatggtagtgttccctgcagagcttagggacatgtgtttcaaaagaaatctcttcgg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
13480 |
tggtaaaatttctttggaagaacaaaaaagcaagagcattaggaatggtagtgttccctgcagagcttggggacatgtgtttcaaaagaaatctcttcgg |
13381 |
T |
 |
| Q |
218 |
aggactgaacctaggatagaggaattccctttctttcctagtaactccacgaaagagaaataggttgcgatttgcatatatcacagtcatccaagagcaa |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
13380 |
aggactgaacctaggatagaggaattccctttctttcctagtaactccacgaaagagaaataggttgcgatttgcatatatcacagtcatccatgagcaa |
13281 |
T |
 |
| Q |
318 |
gcagtgatgat |
328 |
Q |
| |
|
||||||||||| |
|
|
| T |
13280 |
gcagtgatgat |
13270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 218 - 316
Target Start/End: Original strand, 12537462 - 12537560
Alignment:
| Q |
218 |
aggactgaacctaggatagaggaattccctttctttcctagtaactccacgaaagagaaataggttgcgatttgcatatatcacagtcatccaagagca |
316 |
Q |
| |
|
||||||| | |||||||||| ||||| ||||||||||||||| || ||||||||||| ||| ||||||||||||||| | ||| ||||||||||| |
|
|
| T |
12537462 |
aggactgtatctaggatagataaattcttcttctttcctagtaacgccgcgaaagagaaagaggaagcgatttgcatatatgagagtgatccaagagca |
12537560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0096 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: scaffold0096
Description:
Target: scaffold0096; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 216 - 316
Target Start/End: Complemental strand, 29122 - 29022
Alignment:
| Q |
216 |
ggaggactgaacctaggatagaggaattccctttctttcctagtaactccacgaaagagaaataggttgcgatttgcatatatcacagtcatccaagagc |
315 |
Q |
| |
|
||||||||| | |||||||||| ||||| |||||||| |||||| || ||||||||||| ||| ||||||||||||||| | ||| |||||||||| |
|
|
| T |
29122 |
ggaggactgtatctaggatagataaattcttcttctttccaagtaacgccgcgaaagagaaagaggaagcgatttgcatatatgagagtgatccaagagc |
29023 |
T |
 |
| Q |
316 |
a |
316 |
Q |
| |
|
| |
|
|
| T |
29022 |
a |
29022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University