View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5418_low_77 (Length: 280)

Name: NF5418_low_77
Description: NF5418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5418_low_77
NF5418_low_77
[»] chr8 (2 HSPs)
chr8 (23-125)||(37477464-37477566)
chr8 (186-268)||(37477321-37477403)


Alignment Details
Target: chr8 (Bit Score: 103; Significance: 3e-51; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 23 - 125
Target Start/End: Complemental strand, 37477566 - 37477464
Alignment:
23 attttgggtttgtgtttgtacgagatatatgcttgatctgaatttttgttggggaaaaaggttgctttttgaggttttaaaattcgagtaaatctgatga 122  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37477566 attttgggtttgtgtttgtacgagatatatgcttgatctgaatttttgttggggaaaaaggttgctttttgaggttttaaaattcgagtaaatctgatga 37477467  T
123 aca 125  Q
    |||    
37477466 aca 37477464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 186 - 268
Target Start/End: Complemental strand, 37477403 - 37477321
Alignment:
186 aggacaaggggctgcggctataattgaatttttacaagttgtgagttctggttttattttttggcatgtctctattcactctg 268  Q
    |||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||    
37477403 aggacaaggggctgcggctataattgaattttaacaagttctgagttctggttttattttttggcatgtctctattcactctg 37477321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University