View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5418_low_77 (Length: 280)
Name: NF5418_low_77
Description: NF5418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5418_low_77 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 103; Significance: 3e-51; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 23 - 125
Target Start/End: Complemental strand, 37477566 - 37477464
Alignment:
| Q |
23 |
attttgggtttgtgtttgtacgagatatatgcttgatctgaatttttgttggggaaaaaggttgctttttgaggttttaaaattcgagtaaatctgatga |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37477566 |
attttgggtttgtgtttgtacgagatatatgcttgatctgaatttttgttggggaaaaaggttgctttttgaggttttaaaattcgagtaaatctgatga |
37477467 |
T |
 |
| Q |
123 |
aca |
125 |
Q |
| |
|
||| |
|
|
| T |
37477466 |
aca |
37477464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 186 - 268
Target Start/End: Complemental strand, 37477403 - 37477321
Alignment:
| Q |
186 |
aggacaaggggctgcggctataattgaatttttacaagttgtgagttctggttttattttttggcatgtctctattcactctg |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37477403 |
aggacaaggggctgcggctataattgaattttaacaagttctgagttctggttttattttttggcatgtctctattcactctg |
37477321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University