View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5418_low_84 (Length: 267)
Name: NF5418_low_84
Description: NF5418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5418_low_84 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 44623858 - 44623641
Alignment:
| Q |
1 |
gcaactttgaagattaacatctccaaattttgtgattttcaaatgagcgtaaaactttttctatgaattttaacattgatttctaaacttgagttcaact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
44623858 |
gcaactttgaagattaacatctccaaattttgtgattttcaaatgagcgtaaaactttttctatgaattttaacattgttttctaaacttgagttcaact |
44623759 |
T |
 |
| Q |
101 |
ttaattactatcttagaagaaatatgtgtcaagataaaatataaagtttgaaatcctcaatttcaatttttatcataaccannnnnnnnnnaattccaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
44623758 |
ttaattactatcttagaagaaatatgtgtcaagataaaatataaagtttgaaatcctcgatttcaatttttatcataacca--ttttttttaattccaaa |
44623661 |
T |
 |
| Q |
201 |
ccattgtattttagaatcaa |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
44623660 |
ccattgtattttagaatcaa |
44623641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University