View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5418_low_93 (Length: 251)
Name: NF5418_low_93
Description: NF5418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5418_low_93 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 11 - 235
Target Start/End: Complemental strand, 24600878 - 24600654
Alignment:
| Q |
11 |
tatgaatggaaaaattaggcgttgaaagagctttgcactcttattcgcgtccacttgaaccggactcgaattcacaagatccaatgtaacttttggatac |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
24600878 |
tatgaatggaaaaattaggcgttgaaagagctttgcactcttatacgcgtccacttgaaccggactcaaattcacaagatccaatgtaacttttggatac |
24600779 |
T |
 |
| Q |
111 |
tgagagtaaatcaaaatggatgcgacatgcatgtaaaactcatattaaagaaaaaacacacttgagactttgagtaaagctatattttagtaaaattctc |
210 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24600778 |
tgagagtaaaacaaaatgaatgcgacatgcatgtaaaactcatattaaagaaaaaacacacttgagactttgagtaaagctatattttagtaaaattctc |
24600679 |
T |
 |
| Q |
211 |
aatttatgtgtgaaatgattaataa |
235 |
Q |
| |
|
|||| |||||||||||||||||||| |
|
|
| T |
24600678 |
aattcatgtgtgaaatgattaataa |
24600654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University