View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5418_low_99 (Length: 247)
Name: NF5418_low_99
Description: NF5418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5418_low_99 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 24600974 - 24601215
Alignment:
| Q |
1 |
tattcacttgacaggaacaacaagagcttgctgaaagagtgatgttgactcggcttaacctttatgctaaatgggtcaaggtaatggaattcaaaatgca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| || |
|
|
| T |
24600974 |
tattcacttgacaggaacaacaagagcttgctgaaagagtgatgttgactcggcttaacctttatgctaaatgggtcaaggtaatgaaattcaaaattca |
24601073 |
T |
 |
| Q |
101 |
ctacatat------atccaaagacatgtaaaataatttgtgaaggcattaaccattgtttaacaatattattctctatgtgcagaaatgtaatcatgctg |
194 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24601074 |
ctacatatatatatatccaaagacatgtaaaataatttgtgaaggcattaaccattgtttaacaatattattctctatgtgcagaaatgtaatcatgctg |
24601173 |
T |
 |
| Q |
195 |
agatatataatcaaatatcagatgaaaacttggagttgatga |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24601174 |
agatatataatcaaatatcagatgaaaacttggagttgatga |
24601215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University