View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5420_low_2 (Length: 372)
Name: NF5420_low_2
Description: NF5420
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5420_low_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 314; Significance: 1e-177; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 314; E-Value: 1e-177
Query Start/End: Original strand, 21 - 363
Target Start/End: Complemental strand, 43568828 - 43568480
Alignment:
| Q |
21 |
caaagccaagaacagcaatgggtcctggcggtatgattggcgggagtgttgcgaagacgtcgaagtaagtgtctgttagggttttgaaaaggaaagaaat |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
43568828 |
caaagccaagaacagcaatgggtcctggcggtatgattggcgggagtgttgcgaagacgtcgaagtaagtgtctgttagggttttgaataggaaggaaat |
43568729 |
T |
|
| Q |
121 |
gctgtggatgtttccaggattatcaaggaggagaaggcgggaaccgcggaatgggtggtcggcttttctagaaacttctagaacacggatgtagttgtgt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43568728 |
gctgtggatgtttccaggattatcaaggaggagaaggcgggaaccgcggaatgggtggtcggcttttctagaaacttctagaacacggatgtagttgtgt |
43568629 |
T |
|
| Q |
221 |
cttgatttgaatttcgctagtgtttttacgtctttgaatgggatgaagtcttcttgggatttgggttgtttttgttg------ttggcattttggtttgt |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
43568628 |
cttgatttgaatttcgctagtgtttttacgtctttgaatgggatgaagtcttcttgggatttgggttgtttttgttgttggtgttggcattttggtttgt |
43568529 |
T |
|
| Q |
315 |
aagggaaagtgattcttgttgtcttgggtttgaattggagatgatgatg |
363 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43568528 |
aagggaaagtgattcttgttgtcttcggtttgaattggagatgatgatg |
43568480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University