View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5420_low_3 (Length: 251)
Name: NF5420_low_3
Description: NF5420
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5420_low_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 42062993 - 42062752
Alignment:
| Q |
1 |
ccatatctcagtgatagttgacactggagagggatctttgcagcaataagaggataaagtgaagaaagagtgcaatgcgaagttcttttggttcaaagtc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
42062993 |
ccatatctcagtgatagttgacactggagagggatctttgtagcaataagaggataaagtgaagaaagagtgcaaggcaaagttcttttggttcaaagtc |
42062894 |
T |
 |
| Q |
101 |
taaaatttcccttgataggtttcccattaatgtgaagtaactcaccctccccctcatccttcgtattcatttcagttgggatgcttccagcggaaggctg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42062893 |
taaaatttcccttgataggtttcccattattgtgaagcaactcaccctccccctcatctttcgtattcatttcagttgggatgcttccagcggaaggctg |
42062794 |
T |
 |
| Q |
201 |
agttacgttcattacttagctgatcagattggtatgatgatg |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42062793 |
agttacgttcattacttagctgatcagattggtatgatgatg |
42062752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University