View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5422-Insertion-14 (Length: 305)
Name: NF5422-Insertion-14
Description: NF5422
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5422-Insertion-14 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 10 - 305
Target Start/End: Original strand, 34797302 - 34797597
Alignment:
| Q |
10 |
gaatttcaggtatgctttgttccacctataactattcaggcaaattttaggtatgctttgagaatgattatctattgatcattgtcattggcttggctgt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34797302 |
gaatttcaggtatgctttgttccacctataactattcaggcaaattttaggtatgctttgagaatgattatctattgatcattgtcattggcttggctgt |
34797401 |
T |
|
| Q |
110 |
ctactagattaaatgaatgctttgattttatatcaattataagatagaaggtgatgctatcnnnnnnntttatcacctcttgcctactaaattaaacaca |
209 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
34797402 |
ctactatattaaatgaatgctttgattttatatcaattataagatagaaggtgatgctcacaaaaaaatttatcacctcttgcctactaaattaaacaca |
34797501 |
T |
|
| Q |
210 |
aatgaaactaacattggtgcgataagnnnnnnnnccataggttatgtatttattgcacctataaactgaggaagggagaaaaagcataattgttct |
305 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34797502 |
aatgaaactaacattggtgcgataagaaaaaaaaccataggttatgtatttattgcacctataaactgaggaagggagaaaaagcataattgttct |
34797597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University