View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5424_high_7 (Length: 223)

Name: NF5424_high_7
Description: NF5424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5424_high_7
NF5424_high_7
[»] chr8 (1 HSPs)
chr8 (1-209)||(35708390-35708598)


Alignment Details
Target: chr8 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 209
Target Start/End: Complemental strand, 35708598 - 35708390
Alignment:
1 tccattcccctaacccctttctctactccgctctcattcgcgcttacgctcgtaatggacccttccaccattccattcgtttatacacttccatgttaaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35708598 tccattcccctaacccctttctctactccgctctcattcgcgcttacgctcgtaatggacccttccaccattccattcgtttatacacttccatgttaaa 35708499  T
101 taataacgtttctcctgtttctttcactttttcagctcttttttcgttgctaaacaatcctagcttgggatcacagcttcatcttcatgcattcttgttt 200  Q
     ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
35708498 caataacgtttctcctgtttctttcactttttcagctcttttttcgttgctaaagaatcctagcttgggatcacagcttcatcttcatgcattcttgttt 35708399  T
201 ggttttgtt 209  Q
    |||||||||    
35708398 ggttttgtt 35708390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University