View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5424_high_7 (Length: 223)
Name: NF5424_high_7
Description: NF5424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5424_high_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 209
Target Start/End: Complemental strand, 35708598 - 35708390
Alignment:
| Q |
1 |
tccattcccctaacccctttctctactccgctctcattcgcgcttacgctcgtaatggacccttccaccattccattcgtttatacacttccatgttaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35708598 |
tccattcccctaacccctttctctactccgctctcattcgcgcttacgctcgtaatggacccttccaccattccattcgtttatacacttccatgttaaa |
35708499 |
T |
 |
| Q |
101 |
taataacgtttctcctgtttctttcactttttcagctcttttttcgttgctaaacaatcctagcttgggatcacagcttcatcttcatgcattcttgttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35708498 |
caataacgtttctcctgtttctttcactttttcagctcttttttcgttgctaaagaatcctagcttgggatcacagcttcatcttcatgcattcttgttt |
35708399 |
T |
 |
| Q |
201 |
ggttttgtt |
209 |
Q |
| |
|
||||||||| |
|
|
| T |
35708398 |
ggttttgtt |
35708390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University