View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5425_high_1 (Length: 312)
Name: NF5425_high_1
Description: NF5425
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5425_high_1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 36 - 306
Target Start/End: Complemental strand, 3750746 - 3750460
Alignment:
| Q |
36 |
ctcttaaccccatgcttctcaattaagggaaatatgtattggtattcagagtttgaccgcgagttaaatagaatataataaaatattgttctatcgaaat |
135 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
3750746 |
ctcttaaccccatgcttctcaattaggggaaatatgtattggtattcagagtttgaccgcgagttaaatagagtataataaaatattgttctatcgaaat |
3750647 |
T |
|
| Q |
136 |
caagcatcgccatcgatttcaccttaaccgaaacatattatgtaatcttagtcaacattctt----------------cttaaatacttgattttcaatt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3750646 |
caagcatcgccatcgatttcaccttaaccgaaacatattatgtaatcttagtcaacattcttcttagtcaacattcttcttaaatacttgattttcaatt |
3750547 |
T |
|
| Q |
220 |
aataatcaatttaatcatagacaacattaattttaaaaataatagaatatgaactctttttatcaaataaaaatttatattcttgga |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3750546 |
aataatcaatttaatcatagacaacattaattttaaaaataatagaatatgaactctttttatcaaataaaaatttatattattgga |
3750460 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University