View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5425_low_2 (Length: 337)
Name: NF5425_low_2
Description: NF5425
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5425_low_2 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 16 - 318
Target Start/End: Complemental strand, 2094909 - 2094612
Alignment:
| Q |
16 |
attcaggaatagtgcacattttttaagcttttgaagaagttgcacttgttgagtcnnnnnnn-ttaattgctcttattttttctatggacagacataagt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||| |||||||||||||||| |
|
|
| T |
2094909 |
attcaggaatagtgcacattttttaagcttttgaagaagttgcacttgttgagtcaaaaaaaattaattgctcttgttttttttatggacagacataagc |
2094810 |
T |
|
| Q |
115 |
ccctctcttattcttttcgtcatcttgtttgatctactttgattttgatttcaattatctgtttgtccgtagtatgcgatcaaaggtgtttgaacggtca |
214 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2094809 |
ccctttcttattcttttcgtcatcttgtttgatctactttgattt------caattatctgtttgtccgtagtatgcgatcaaaggtgtttgaacggtca |
2094716 |
T |
|
| Q |
215 |
ggacctatgttggaccatccaactattagagatgatctatatccattttttgacccataatttcattcatacaaagacaaaaatgatacactgcatcata |
314 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
2094715 |
ggacctatgttggaccatccagctattagagaggatctatatccattttttgacccataatttcattcatacaaagacaaaaatgatacaccgcgtcata |
2094616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University