View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5425_low_4 (Length: 250)
Name: NF5425_low_4
Description: NF5425
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5425_low_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 1 - 110
Target Start/End: Complemental strand, 39185428 - 39185319
Alignment:
| Q |
1 |
tttgtgtttttgtttcagattcgttgttgtatcttcgaattcgagtttgggactcttaggattggggtttatatcgttctgttgggtctctgagacttgc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
39185428 |
tttgtgtttttgtttcagattcgttgttgtatctttgaattcgagtttgggtctcttaggattggggtttctatcgttctgttgggtctctgagacttgc |
39185329 |
T |
|
| Q |
101 |
tgctattgct |
110 |
Q |
| |
|
|||||||||| |
|
|
| T |
39185328 |
tgctattgct |
39185319 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University