View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5426_high_10 (Length: 237)

Name: NF5426_high_10
Description: NF5426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5426_high_10
NF5426_high_10
[»] chr3 (1 HSPs)
chr3 (13-222)||(11611731-11611943)


Alignment Details
Target: chr3 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 13 - 222
Target Start/End: Original strand, 11611731 - 11611943
Alignment:
13 cttgatgaattgtgaaaatgaaaatgaatgcactctt----tatagttagactaacttgttgatatgtttgttttgtgttgctattagttttcctggaga 108  Q
    ||||||||||||||||| |||||||||||||| | ||    |||||||||||||||||||| |||||||||||||||||||| |||||| |||| |||||    
11611731 cttgatgaattgtgaaactgaaaatgaatgcattttttatatatagttagactaacttgttaatatgtttgttttgtgttgc-attagtcttcccggaga 11611829  T
109 caacggattcgatccattgggacttgcagaagatccagagaacttgaaatggtttgttcaagccgagcttgtgaatggacgttgggctatgttaggtgtt 208  Q
    |||||||||||||||||||||||| || || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11611830 caacggattcgatccattgggactagccgaggatccagagaacttgaaatggtttgttcaagccgagcttgtgaatggacgttgggctatgttaggtgtt 11611929  T
209 gcagggatgttact 222  Q
    ||||||||||||||    
11611930 gcagggatgttact 11611943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University