View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5426_high_12 (Length: 224)
Name: NF5426_high_12
Description: NF5426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5426_high_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 6e-95; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 20 - 203
Target Start/End: Original strand, 27940062 - 27940245
Alignment:
| Q |
20 |
ctgtgcaaaaaagctacttgaatgaagatgttagagaaggatattttgcagtggttgcaatcaaagatggagaaatgaaaaggtttatgattgggttaga |
119 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27940062 |
ctgttcaaaaaagccacttgaatgaagatgttagagaaggatattttgcagtggttgcaatcaaagatggagaaatgaaaaggtttatgattgggttaga |
27940161 |
T |
|
| Q |
120 |
gtatttgagtgatcctgcatttttgggattacttgatcaagctagggaagagtatggttttagacagcaaggaattcttgcagt |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27940162 |
gtatttgagtgatcctgcatttttgggattacttgatcaagctagggaagagtatggttttagacagcaaggaattcttgcagt |
27940245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 43 - 192
Target Start/End: Original strand, 27956174 - 27956323
Alignment:
| Q |
43 |
gaagatgttagagaaggatattttgcagtggttgcaatcaaagatggagaaatgaaaaggtttatgattgggttagagtatttgagtgatcctgcatttt |
142 |
Q |
| |
|
||||||||||| |||||||| ||||| || |||||||| || |||||||||| ||||||||||| ||||| ||||| || ||||||||||||| ||| | |
|
|
| T |
27956174 |
gaagatgttagggaaggatactttgctgttgttgcaatgaaggatggagaaactaaaaggtttatcattggtttagaatacttgagtgatcctgaattct |
27956273 |
T |
|
| Q |
143 |
tgggattacttgatcaagctagggaagagtatggttttagacagcaagga |
192 |
Q |
| |
|
||||| |||| ||||||||| ||||||||||||||||| |||| ||||| |
|
|
| T |
27956274 |
tgggactactagatcaagctcaggaagagtatggttttatacagaaagga |
27956323 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 43 - 192
Target Start/End: Original strand, 27959359 - 27959508
Alignment:
| Q |
43 |
gaagatgttagagaaggatattttgcagtggttgcaatcaaagatggagaaatgaaaaggtttatgattgggttagagtatttgagtgatcctgcatttt |
142 |
Q |
| |
|
||||||||||| |||||||| ||||| || |||||||| ||||||||||||| |||| |||||| |||||||| ||||| || |||||||||| |||| |
|
|
| T |
27959359 |
gaagatgttagggaaggatactttgctgtcgttgcaatgaaagatggagaaaccaaaaagtttattattgggttggagtacttaagtgatcctgagtttt |
27959458 |
T |
|
| Q |
143 |
tgggattacttgatcaagctagggaagagtatggttttagacagcaagga |
192 |
Q |
| |
|
|||||||||| | |||||| ||||||||||||||| | |||| ||||| |
|
|
| T |
27959459 |
tgggattactaggtcaagcacaggaagagtatggtttcatacaggaagga |
27959508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 99 - 199
Target Start/End: Original strand, 27896297 - 27896397
Alignment:
| Q |
99 |
aaggtttatgattgggttagagtatttgagtgatcctgcatttttgggattacttgatcaagctagggaagagtatggttttagacagcaaggaattctt |
198 |
Q |
| |
|
||||||||| |||||||||| || || | ||||||||| ||||||||||| |||||| | ||| |||| |||||||||||||||||| | |||| |||| |
|
|
| T |
27896297 |
aaggtttattgttgggttagattacttaactgatcctgcttttttgggattgcttgatgatgcttgggaggagtatggttttagacagaagggaactctt |
27896396 |
T |
|
| Q |
199 |
g |
199 |
Q |
| |
|
| |
|
|
| T |
27896397 |
g |
27896397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 99 - 199
Target Start/End: Original strand, 27929961 - 27930061
Alignment:
| Q |
99 |
aaggtttatgattgggttagagtatttgagtgatcctgcatttttgggattacttgatcaagctagggaagagtatggttttagacagcaaggaattctt |
198 |
Q |
| |
|
||||||||| |||||||||| || || | ||||||||| ||||||||||| |||||| | ||| |||| |||||||||||||||||| | |||| |||| |
|
|
| T |
27929961 |
aaggtttattgttgggttagattacttaactgatcctgcttttttgggattgcttgatgatgcttgggaggagtatggttttagacagaagggaactctt |
27930060 |
T |
|
| Q |
199 |
g |
199 |
Q |
| |
|
| |
|
|
| T |
27930061 |
g |
27930061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University