View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5426_high_15 (Length: 211)
Name: NF5426_high_15
Description: NF5426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5426_high_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 19 - 202
Target Start/End: Original strand, 2600671 - 2600854
Alignment:
| Q |
19 |
ctttgatcgttgaccctttttcccaaaaggactacagaatccacacgcagagacctttggagacggtggttcgatcgctggtgaaacttttccggtacgg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2600671 |
ctttgatcgttgaccctttttcccaaaaggactacagaatccacacgcggagacctttggagacggtggttcgatcgctggtgaaacttttccggtacgg |
2600770 |
T |
|
| Q |
119 |
tatcctcgtccagcaccggtggagcggcttctttgtacggtggttttcacatgaagctctttggaattattagtagtattatct |
202 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2600771 |
tatcctcttccagcaccggtggaatggcttctttgtacggtggttttcacacgaagctctttggaattattagtagtattatct |
2600854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 37 - 153
Target Start/End: Complemental strand, 44510605 - 44510489
Alignment:
| Q |
37 |
tttcccaaaaggactacagaatccacacgcagagacctttggagacggtggttcgatcgctggtgaaacttttccggtacggtatcctcgtccagcaccg |
136 |
Q |
| |
|
||||||||||| || ||| || ||||| ||||| | | | ||||||||||| || ||||| || |||||||||||||||||||| || ||||| ||||| |
|
|
| T |
44510605 |
tttcccaaaagcaccacaaaacccacaagcagaaatcctaggagacggtggctcaatcgccggagaaacttttccggtacggtaaccacgtcctccaccg |
44510506 |
T |
|
| Q |
137 |
gtggagcggcttctttg |
153 |
Q |
| |
|
|||| || |||||||| |
|
|
| T |
44510505 |
ttggaacgacttctttg |
44510489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University