View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5426_low_10 (Length: 237)
Name: NF5426_low_10
Description: NF5426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5426_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 13 - 222
Target Start/End: Original strand, 11611731 - 11611943
Alignment:
| Q |
13 |
cttgatgaattgtgaaaatgaaaatgaatgcactctt----tatagttagactaacttgttgatatgtttgttttgtgttgctattagttttcctggaga |
108 |
Q |
| |
|
||||||||||||||||| |||||||||||||| | || |||||||||||||||||||| |||||||||||||||||||| |||||| |||| ||||| |
|
|
| T |
11611731 |
cttgatgaattgtgaaactgaaaatgaatgcattttttatatatagttagactaacttgttaatatgtttgttttgtgttgc-attagtcttcccggaga |
11611829 |
T |
 |
| Q |
109 |
caacggattcgatccattgggacttgcagaagatccagagaacttgaaatggtttgttcaagccgagcttgtgaatggacgttgggctatgttaggtgtt |
208 |
Q |
| |
|
|||||||||||||||||||||||| || || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11611830 |
caacggattcgatccattgggactagccgaggatccagagaacttgaaatggtttgttcaagccgagcttgtgaatggacgttgggctatgttaggtgtt |
11611929 |
T |
 |
| Q |
209 |
gcagggatgttact |
222 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
11611930 |
gcagggatgttact |
11611943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University