View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5426_low_14 (Length: 213)
Name: NF5426_low_14
Description: NF5426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5426_low_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 35 - 197
Target Start/End: Complemental strand, 1281057 - 1280895
Alignment:
| Q |
35 |
gggtttgtatctaaaatttcaagctattattatgccttgttgcactgttttaatattatatttaagattaacattatgtgaagcttcaatttgggataat |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
1281057 |
gggtttgtatctaaaatttcaagctattattatgccttgttgcactgttttaatattatatttaagattaacattatgcgaagcttcaatttgggataac |
1280958 |
T |
 |
| Q |
135 |
cggccgattttccagttggtttgatcttggttatattgcagtttggttgaaccggggttgaac |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1280957 |
cggccgattttccagttggtttgatcttggttatattgcagtttggttgaaccggggttgaac |
1280895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University