View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5426_low_7 (Length: 261)
Name: NF5426_low_7
Description: NF5426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5426_low_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 10 - 219
Target Start/End: Complemental strand, 18642905 - 18642696
Alignment:
| Q |
10 |
attattctatatgtttagatgtgaatcactgtactttggttgcaggttagatcttagctgtcctctatccagtgcagtatactgaagatcccggtcacag |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18642905 |
attattctatatgtttagatgtgaatcactgtactttggttgcaggttagatctttgctgtcctctatccagtgcagtatactgaagatcccggtcacag |
18642806 |
T |
|
| Q |
110 |
atggctctagtaatacaacaaaaggtcttttagttgctttggtttcttggtcatggatacgtaacattaagttgaatgacttaatgagatttgaaacatg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18642805 |
atggctctagtaatacaacaaaaggtcttttagttgctttggtttcttggtcatggatacgtaacattaagttgaatgacttaatgagatttgaaacatg |
18642706 |
T |
|
| Q |
210 |
ttttaatttt |
219 |
Q |
| |
|
|||||||||| |
|
|
| T |
18642705 |
ttttaatttt |
18642696 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University