View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5427-Insertion-4 (Length: 285)
Name: NF5427-Insertion-4
Description: NF5427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5427-Insertion-4 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 52; Significance: 7e-21; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 206 - 285
Target Start/End: Complemental strand, 28472399 - 28472320
Alignment:
| Q |
206 |
atccctcttggatcaatggcaagaagtatgtttttcaaacttttatttcttgcctcggctatttccatcccttctctgct |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||| |||||||||| |||||||||||| ||||||||| |
|
|
| T |
28472399 |
atccctcttggatcaatggcaagaagtatgtttttcaaagcattacttcttgcctctgctatttccatcgtttctctgct |
28472320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University