View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5427-Insertion-6 (Length: 230)
Name: NF5427-Insertion-6
Description: NF5427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5427-Insertion-6 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 35 - 230
Target Start/End: Complemental strand, 44884359 - 44884164
Alignment:
| Q |
35 |
acctccagaatatgatagatgagtatgatcgtttgtcttcaaaccctcctccttcaccttctcgactcagattgttcctcttcttctcaaaaccagatac |
134 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44884359 |
acctccagaatatgatagatgagtatgatcgtttgtcttcaaacccttctccttcaccttctcgactcagattgttcctcttcttctcaaaaccagatac |
44884260 |
T |
|
| Q |
135 |
tgctgtttccacgggagatggtcacttttataatcatgcgtggtttgtggaagctctcaacaactcagggattctgtctcgggttgtttcggattc |
230 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
44884259 |
tgctgtttccatgggaaatggtcacttttataatcatgcatggtttgtggaagctctcaacaactcagggattctgtctcgtgttgtttcagattc |
44884164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 75; Significance: 1e-34; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 102 - 224
Target Start/End: Original strand, 8994206 - 8994328
Alignment:
| Q |
102 |
cagattgttcctcttcttctcaaaaccagatactgctgtttccacgggagatggtcacttttataatcatgcgtggtttgtggaagctctcaacaactca |
201 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |||||||| ||| ||| ||||||| ||||||||| |||||||||||||||||| ||||| ||| |
|
|
| T |
8994206 |
cagattgttcctattcttctcaaaaccagatactgatgtttccatgggtaatgatcactttgataatcatgtgtggtttgtggaagctctgaacaaatca |
8994305 |
T |
|
| Q |
202 |
gggattctgtctcgggttgtttc |
224 |
Q |
| |
|
|||||||| ||||| |||||||| |
|
|
| T |
8994306 |
gggattctctctcgtgttgtttc |
8994328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 102 - 224
Target Start/End: Original strand, 9028863 - 9028985
Alignment:
| Q |
102 |
cagattgttcctcttcttctcaaaaccagatactgctgtttccacgggagatggtcacttttataatcatgcgtggtttgtggaagctctcaacaactca |
201 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |||||||| ||| ||| ||||||| ||||||||| |||||||||||||||||| ||||| ||| |
|
|
| T |
9028863 |
cagattgttcctattcttctcaaaaccagatactgatgtttccatgggtaatgatcactttgataatcatgtgtggtttgtggaagctctgaacaaatca |
9028962 |
T |
|
| Q |
202 |
gggattctgtctcgggttgtttc |
224 |
Q |
| |
|
|||||||| ||||| |||||||| |
|
|
| T |
9028963 |
gggattctctctcgtgttgtttc |
9028985 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 63 - 144
Target Start/End: Original strand, 9019385 - 9019466
Alignment:
| Q |
63 |
tcgtttgtcttcaaaccctcctccttcaccttctcgactcagattgttcctcttcttctcaaaaccagatactgctgtttcc |
144 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||||||||||||||| | ||| |||||||||||||||||||| ||||| |
|
|
| T |
9019385 |
tcgtttgtcttcaaacccgtctccttccccttctcgactcagattgttcatgttcatctcaaaaccagatactgctatttcc |
9019466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University