View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5427-Insertion-7 (Length: 175)
Name: NF5427-Insertion-7
Description: NF5427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5427-Insertion-7 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 107; Significance: 6e-54; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 107; E-Value: 6e-54
Query Start/End: Original strand, 15 - 175
Target Start/End: Complemental strand, 43314673 - 43314510
Alignment:
| Q |
15 |
tcagccagaaatccgtggacgaaaacatgtggtaattaaagcaacttcttgattcctgtatgccaattcaattggatttcatcaaaattttagtctttat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43314673 |
tcagccagaaatccgtggacgaaaacatgtggtaattaaatcaacttcttgattcctgtatgccaattcaattggatttcatcaaaattttagtctttat |
43314574 |
T |
|
| Q |
115 |
ttattctag---tcnnnnnnnnnctcttgtagcaaatgttcgatgaaactagaaatcgacaaca |
175 |
Q |
| |
|
||| ||||| | |||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
43314573 |
ttactctagtgttttttttttctctctcgtagcaaatgttcgatgaaactagaaatcgacaaca |
43314510 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University