View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5427_high_1 (Length: 491)
Name: NF5427_high_1
Description: NF5427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5427_high_1 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 316; Significance: 1e-178; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 101 - 445
Target Start/End: Complemental strand, 34743714 - 34743374
Alignment:
| Q |
101 |
cagaactttaaggccaagctgtttagcttcagaagtgaagagacgagggtaagtgatgagttctctgaggatttgaatagctttagcgttgccaccgacg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34743714 |
cagaactttaaggccaagctgtttagcttcagaagtgaagagacgagggtaagtgatgagttctctgaggatttgaatagctttagcgttgccaccgacg |
34743615 |
T |
 |
| Q |
201 |
acatcctctgctttctggtgaccgttagtgctgctggtgcagctttcagtttctccacacattgttgatgaaatggaggaacgaggaagaacaagcggcg |
300 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34743614 |
acatcctctgctttatggtgaccgttggtgctgctggtgcagctttcagtttctccacacattgttgatgaaatggaggaacgaggaagaacaagcggcg |
34743515 |
T |
 |
| Q |
301 |
ctggttatttactgaatgtgaaaattgattgatggccaaggtaggttttttggattcgctacattcatgcagtagagtaattctcagccattcgatgcat |
400 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34743514 |
ctggttatttactgaatgtgaaaat----tgatggccaaggtaggttttttggattcgctacattcatgcagtagagtaattctcagccattcgatgcat |
34743419 |
T |
 |
| Q |
401 |
ctgatggttcagaaaaatcgcaattcactactataaaaaacaaat |
445 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
34743418 |
ctgatggttcagaaaaatcgcaattcattactataaaaaacaaat |
34743374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University