View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5427_high_14 (Length: 269)
Name: NF5427_high_14
Description: NF5427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5427_high_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 165; Significance: 3e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 1 - 252
Target Start/End: Original strand, 41693887 - 41694148
Alignment:
| Q |
1 |
tatgtggagtgaaggaatcaagttttgttaggacttatccannnnnnngggaggaacctttcaaagcactctattgtctaataataattaatgtgnnnnn |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41693887 |
tatgtggagtgaaggaatcaagttttgttaggacttatccatttttttgggaggaacctttcaaagcactctattgtctaataataattaatgtgttttt |
41693986 |
T |
 |
| Q |
101 |
nnnnnngttctatacccgtggttttttattttaatgata----------caacttgagataaatatgtactttattgtcactccctaccgttgtttctta |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41693987 |
ttttttgttctatacccgtggttttttattttaatgatgtttgaaagggcaacttgagataaatatgtactttattgtcactccctaccgttgtttctta |
41694086 |
T |
 |
| Q |
191 |
tgaaatatctcgtgtctatgattgacaaaagactaaaccaaaacgcgattggcatttagttg |
252 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41694087 |
tgaaatatcttgtgtctatgattgacaaaagactaaaccaaaacgcgattggcatttagttg |
41694148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University