View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5427_high_21 (Length: 251)
Name: NF5427_high_21
Description: NF5427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5427_high_21 |
 |  |
|
| [»] scaffold0085 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0085 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 10 - 242
Target Start/End: Original strand, 31739 - 31971
Alignment:
| Q |
10 |
ttattcttttaggtgagccgggttttttcttaaacataataggttgaattaattagggtgaacttcttatcgcacccttcaattgctctaagactcactt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31739 |
ttattcttttaggtgagccgggttttttcttaaacataataggttgaattaattagggtgaacttcttatcgcacccttcaattgctctaagactcactt |
31838 |
T |
 |
| Q |
110 |
ttcggattttagaatccaaaaaatctggctttgttcttcctaattttacccattggggagaagtagtgggggagtgataacaaattgctttaattatgaa |
209 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31839 |
ttcggattttagaatccaaaaaaactggttttgttcttcctaattttacccattggggagaagtagtgggggagtgataacaaattgctttaattatgaa |
31938 |
T |
 |
| Q |
210 |
taattgtctacttttttgacatattagtgctct |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
31939 |
taattgtctacttttttgacatattagtgctct |
31971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University