View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5427_high_23 (Length: 246)
Name: NF5427_high_23
Description: NF5427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5427_high_23 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 14 - 231
Target Start/End: Complemental strand, 6201072 - 6200855
Alignment:
| Q |
14 |
agggtgagattttattatcgacatctattatgagtaacgtacatgatatagtttatttctatacacaggcctccttttcttttttgaagtcttagcagct |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6201072 |
agggtgagattttattatcgacatctattatgagtaacgtacatgatatagtttatttctatacacaggcctccttttcttttttgaagtcttagcagct |
6200973 |
T |
 |
| Q |
114 |
tcttttgcttacaggttagctggtgcaaatttgaagtgattgttgactctcctaaagacatcagggcttcttctccatcttcttcaaaaatcactctagt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6200972 |
tcttttgcttacaggttagctggtgcaaatttgaagtgattgttgactctcctaaagacatcagggcttcttctccatcttcttcaaaaatcactctagt |
6200873 |
T |
 |
| Q |
214 |
gaatccccctgtggttgt |
231 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
6200872 |
gaatccccctgtggttgt |
6200855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University