View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5427_high_27 (Length: 239)
Name: NF5427_high_27
Description: NF5427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5427_high_27 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 15 - 223
Target Start/End: Original strand, 25989745 - 25989955
Alignment:
| Q |
15 |
agagagctagagagaaaatgaattattgaatgagtttaggaaaattaaggatattcaaatgtaagtat-gattaaagtattgcaaccgatcaacttgaac |
113 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
25989745 |
agagagctagagagaaaatgaattgttgaatgagtttaggaaaattaaggatattcaaatgtaagtattgattaaagtattgcaaccgatcaacttgaac |
25989844 |
T |
 |
| Q |
114 |
ttaaaattttgtgagtgacctttcgaacacagcacaagggaacgataaaagcatatcaaagaaaacgttaaggcaaag-aacaatcaaacaaaacaagta |
212 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
25989845 |
ataaaatttggtgagtgacctttcgaacacagcacaagggaacgataaaagcatatcaaagaaaacgttgaggcaaagaaacaatcaaacaaaacaagta |
25989944 |
T |
 |
| Q |
213 |
tgctagattat |
223 |
Q |
| |
|
||||||||||| |
|
|
| T |
25989945 |
tgctagattat |
25989955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University