View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5427_high_28 (Length: 239)
Name: NF5427_high_28
Description: NF5427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5427_high_28 |
 | |
|
| [»] scaffold0085 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0085 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 19 - 239
Target Start/End: Complemental strand, 32438 - 32219
Alignment:
| Q |
19 |
tgagttcaattcccgctaccgatttaaaaacctctttgattgattacatgtaagtatatttgtaagtgctcgatgaacctaaaaaccggtcttgactctg |
118 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
32438 |
tgagttcaattcccactaccgatttaagaacctctttgattgattacatgtaagtatatttgtaagtgctcgatgaacctaaaaatcggtcttgactctg |
32339 |
T |
|
| Q |
119 |
atgagccttcagaatccaaacacctaaacnnnnnnnncttccataaagcataaaaaatatgtcccgaacattattgatgtaaattattaatacttttgct |
218 |
Q |
| |
|
|| ||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32338 |
atcagccttcagaatccaaagacctaaac-tttttttcttccataaagcataaaaaatatgtcccgaacattattgatgtaaattattaatacttttgct |
32240 |
T |
|
| Q |
219 |
ttaaaattttaaaaacggtgt |
239 |
Q |
| |
|
||||||||||||||| ||||| |
|
|
| T |
32239 |
ttaaaattttaaaaatggtgt |
32219 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University