View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5427_high_8 (Length: 340)
Name: NF5427_high_8
Description: NF5427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5427_high_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 124; Significance: 9e-64; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 124; E-Value: 9e-64
Query Start/End: Original strand, 16 - 154
Target Start/End: Complemental strand, 36220008 - 36219869
Alignment:
| Q |
16 |
cattattgtcaactgccgtcgacgaatccgatctactcccgccggatgccactctttccgactccgacggcggctttccttcaatggatagcatgttaca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
36220008 |
cattattgtcaactgccgtcgacgaatccgatctactcccgccggatgccgctctttccgactccgacggcgggtttccttcaatggatagcatgttaca |
36219909 |
T |
 |
| Q |
116 |
ctgggcaataagtatgtatag-ttattaattaacatgctg |
154 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
36219908 |
ctgggcaataagtatgtatagtttattaattaacatgctg |
36219869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 116; E-Value: 6e-59
Query Start/End: Original strand, 210 - 325
Target Start/End: Complemental strand, 36219813 - 36219698
Alignment:
| Q |
210 |
aggtcattctgatcctgaaaagttgaaggaatcagcacaatctcatcaaaagttatcaccgagtgaacttcagaagcgtcaattagaaatcaaagtaatt |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36219813 |
aggtcattctgatcctgaaaagttgaaggaatcagcacaatctcatcaaaagttatcaccgagtgaacttcagaagcgtcaattagaaatcaaagtaatt |
36219714 |
T |
 |
| Q |
310 |
caagttttctatgtgt |
325 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
36219713 |
caagttttctatgtgt |
36219698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University