View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5427_low_10 (Length: 328)
Name: NF5427_low_10
Description: NF5427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5427_low_10 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 229; Significance: 1e-126; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 92 - 328
Target Start/End: Original strand, 10794703 - 10794939
Alignment:
| Q |
92 |
gaatatttgattgattactaactgtctgaaattatgtagtagtttgttgaaggaaaatggaatacctgaggttgctaactactaccatgtaaatcccata |
191 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10794703 |
gaatatttgattgattactaactgtctggaattctgtagtagtttgttgaaggaaaatggaatacctgaggttgctaactactaccatgtaaatcccata |
10794802 |
T |
 |
| Q |
192 |
tgctacactggttgagattacaggtaaattctcaacagtaaatgctttatttacagccttctgtgcattgatcaaggcatttgttatacctataccaacc |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10794803 |
tgctacactggttgagattacaggtaaattctcaacagtaaatgctttatttacagccttctgtgcattgatcaaggcatttgttatacctataccaacc |
10794902 |
T |
 |
| Q |
292 |
tgaataaaaaatattgcaagcactcatgttagaaatt |
328 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10794903 |
tgaataaaaaatattgcaagcactcatgttagaaatt |
10794939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 17 - 87
Target Start/End: Original strand, 10794522 - 10794592
Alignment:
| Q |
17 |
acttgatacctgatcacataaacaaatccacaataatttgaggatataaattactgaacttaaacttatgt |
87 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
10794522 |
acttgatacctgatcacataaacaaatccacaataatttgaggatataaattactgaacttaaacatatgt |
10794592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University