View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5427_low_17 (Length: 264)
Name: NF5427_low_17
Description: NF5427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5427_low_17 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 5 - 264
Target Start/End: Complemental strand, 40672116 - 40671857
Alignment:
| Q |
5 |
tgtcgaagaatattggaagagattgttattgttgttatcagccgattggtttatcggaagggagtagatttgcttgtcgaagtcatcccgcaagtatgcc |
104 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40672116 |
tgtccaagaagattggaagagattgttattgttgttatcagccgattggtttatcggaagggagtagatttgcttgtcgaagtcatcccgcaagtatgcc |
40672017 |
T |
|
| Q |
105 |
ggttacattccaatgtgagttgataaaagcattgtctgnnnnnnnatcttgcataactaggaaattttgcataccccatttggaatgttttggcttttca |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40672016 |
ggttacattccaatgtgagttgataaaagcattgtctgtttttttgtcttgcataactaggaaattttgcataccccatttggaatgttttggcttttca |
40671917 |
T |
|
| Q |
205 |
taatggttcttatagttacaaatattttgtttggtgaattttctgtggtgcttgccctga |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40671916 |
taatggttcttatagttacaaatattttgtttggtgaattttctgtggtgcttgccctga |
40671857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 26 - 90
Target Start/End: Original strand, 35685059 - 35685123
Alignment:
| Q |
26 |
attgttattgttgttatcagccgattggtttatcggaagggagtagatttgcttgtcgaagtcat |
90 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| || || |||| || |||||||| |||||||| |
|
|
| T |
35685059 |
attgttattgttgttatcagtcgattggtttaccgtaaaggagccgacttgcttgttgaagtcat |
35685123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University