View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5427_low_23 (Length: 251)

Name: NF5427_low_23
Description: NF5427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5427_low_23
NF5427_low_23
[»] scaffold0085 (1 HSPs)
scaffold0085 (10-242)||(31739-31971)


Alignment Details
Target: scaffold0085 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: scaffold0085
Description:

Target: scaffold0085; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 10 - 242
Target Start/End: Original strand, 31739 - 31971
Alignment:
10 ttattcttttaggtgagccgggttttttcttaaacataataggttgaattaattagggtgaacttcttatcgcacccttcaattgctctaagactcactt 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31739 ttattcttttaggtgagccgggttttttcttaaacataataggttgaattaattagggtgaacttcttatcgcacccttcaattgctctaagactcactt 31838  T
110 ttcggattttagaatccaaaaaatctggctttgttcttcctaattttacccattggggagaagtagtgggggagtgataacaaattgctttaattatgaa 209  Q
    ||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31839 ttcggattttagaatccaaaaaaactggttttgttcttcctaattttacccattggggagaagtagtgggggagtgataacaaattgctttaattatgaa 31938  T
210 taattgtctacttttttgacatattagtgctct 242  Q
    |||||||||||||||||||||||||||||||||    
31939 taattgtctacttttttgacatattagtgctct 31971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University