View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5427_low_29 (Length: 239)

Name: NF5427_low_29
Description: NF5427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5427_low_29
NF5427_low_29
[»] chr2 (1 HSPs)
chr2 (15-223)||(25989745-25989955)


Alignment Details
Target: chr2 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 15 - 223
Target Start/End: Original strand, 25989745 - 25989955
Alignment:
15 agagagctagagagaaaatgaattattgaatgagtttaggaaaattaaggatattcaaatgtaagtat-gattaaagtattgcaaccgatcaacttgaac 113  Q
    |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
25989745 agagagctagagagaaaatgaattgttgaatgagtttaggaaaattaaggatattcaaatgtaagtattgattaaagtattgcaaccgatcaacttgaac 25989844  T
114 ttaaaattttgtgagtgacctttcgaacacagcacaagggaacgataaaagcatatcaaagaaaacgttaaggcaaag-aacaatcaaacaaaacaagta 212  Q
     |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||    
25989845 ataaaatttggtgagtgacctttcgaacacagcacaagggaacgataaaagcatatcaaagaaaacgttgaggcaaagaaacaatcaaacaaaacaagta 25989944  T
213 tgctagattat 223  Q
    |||||||||||    
25989945 tgctagattat 25989955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University