View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5427_low_31 (Length: 238)
Name: NF5427_low_31
Description: NF5427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5427_low_31 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 135; Significance: 2e-70; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 20 - 182
Target Start/End: Complemental strand, 12842473 - 12842311
Alignment:
| Q |
20 |
actcaaacgtataaatattagctagattgaatcataaaaatggtgacaaatataagaatctagaaggtgatatttagacaatctttggacatggagggac |
119 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
12842473 |
actcaaacgtataaatattagatagattgaatcataaaaatggtgacaaatataagaaactataaggtgatatttagacaatcttcggacatggagggac |
12842374 |
T |
 |
| Q |
120 |
cgattgcctctatttgaatgcacctaattctgtcactatttggataaatacgacgaaatgata |
182 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
12842373 |
cgattgcctatatttgaatgcacctaattctgtcactattgggataaatacaacgaaatgata |
12842311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 20 - 103
Target Start/End: Complemental strand, 12841147 - 12841063
Alignment:
| Q |
20 |
actcaaacgtata-aatattagctagattgaatcataaaaatggtgacaaatataagaatctagaaggtgatatttagacaatct |
103 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
12841147 |
actcaaacgtatagaatattagctagattgaatcataacaatggtgacaaatataagaaactagaaggtgatatttagacaatct |
12841063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 130 - 180
Target Start/End: Original strand, 12863081 - 12863131
Alignment:
| Q |
130 |
tatttgaatgcacctaattctgtcactatttggataaatacgacgaaatga |
180 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||| |||| |||| |
|
|
| T |
12863081 |
tatttgaatgcacctaattctgtcactgtttggataaatacaacgagatga |
12863131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 186 - 222
Target Start/End: Complemental strand, 12841065 - 12841029
Alignment:
| Q |
186 |
tctagttgattttcttaaatagaagatggtctattat |
222 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |
|
|
| T |
12841065 |
tctagttgattttcttaagtagaagatggtctattat |
12841029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University