View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5427_low_36 (Length: 220)
Name: NF5427_low_36
Description: NF5427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5427_low_36 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 144; Significance: 7e-76; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 36 - 220
Target Start/End: Original strand, 41693345 - 41693529
Alignment:
| Q |
36 |
aatatatcataatcacgtgatccaccatgattttgacgttagcttgcagagtgtagcttggaaatcacggtggctcaccgtgatttagcataccaacgga |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
41693345 |
aatatatcataatcacgtgatccaccatgattttgacgttagcctgcagagtgtagcctggaaatcacggtggctcaccgtgatttggcataccaacgga |
41693444 |
T |
 |
| Q |
136 |
gatgccaaacttaagctaagcaaatacaaaagaaatagatgnnnnnnntaataaccaagcaaagtgagtgataatcacatgatca |
220 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41693445 |
gatgccaaacttaagctaagtaaatacaaaagaaagagatgaaaaaaataataaccaagcaaagtgagtgataatcacatgatca |
41693529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 40
Target Start/End: Original strand, 41693287 - 41693326
Alignment:
| Q |
1 |
ctggtagtagtaataataagtataacaagaaattaaatat |
40 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41693287 |
ctggtagtagtaataataagtataacaagaaattaaatat |
41693326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University