View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5427_low_38 (Length: 201)

Name: NF5427_low_38
Description: NF5427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5427_low_38
NF5427_low_38
[»] chr2 (1 HSPs)
chr2 (19-135)||(32327911-32328027)


Alignment Details
Target: chr2 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 19 - 135
Target Start/End: Original strand, 32327911 - 32328027
Alignment:
19 ggaagggatggtgggggagtgtatcgtaggtgaatttggatggagcttggtggtgataatgttcatggttcaccaacatgaaccaattttatatggagcc 118  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32327911 ggaagggatggtgggggagtgtatcataggtgaatttggatggagcttggtggtgataatgttcatggttcaccaacatgaaccaattttatatggagcc 32328010  T
119 attgttcaaagctatag 135  Q
    |||||||||||||||||    
32328011 attgttcaaagctatag 32328027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University