View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5428-Insertion-4 (Length: 321)
Name: NF5428-Insertion-4
Description: NF5428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5428-Insertion-4 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 8 - 321
Target Start/End: Complemental strand, 46512596 - 46512282
Alignment:
| Q |
8 |
ataattcggttgtttgaaacatannnnnnnatttatttgtttataattaggttgggaaattgctcattgttttatagctttatgtgaagtgggagacaat |
107 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46512596 |
ataattcggttgtttgaaacatatttttttatttatttgtttataattaggttgggaaattgctcattgttttatagctttatgtgaagtgggagacaat |
46512497 |
T |
 |
| Q |
108 |
ttttggcatatgatgaatgtgtgttgatagggtcagtttgaggnnnnnnnnn--gttactggggatgtatgtattctgtggcttcttttttcctgtcatt |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||| |||||||| |
|
|
| T |
46512496 |
ttttggcatatgatgaatgtgtgttgatagggtcagtttgaggtttttttttttgttactggg-atgtatgtattctgtggcttcttttttgctgtcatt |
46512398 |
T |
 |
| Q |
206 |
gtcaaatgtctagatatctgtaactttaatattatctctattctgggtttgcacnnnnnnnactttctcatatttaattgttgttttcagttttcacttc |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46512397 |
gtcaaatgtctagatatctgtaactttaatattatctctattctgggtttgcactttttttactttctcatatttaattgttgttttcagttttcacttc |
46512298 |
T |
 |
| Q |
306 |
atgccgggttttagtg |
321 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
46512297 |
atgccgggttttagtg |
46512282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University