View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5429-Insertion-3 (Length: 210)
Name: NF5429-Insertion-3
Description: NF5429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5429-Insertion-3 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 8 - 210
Target Start/End: Original strand, 7904899 - 7905101
Alignment:
| Q |
8 |
ctgagaatggtgcaaagatttttgtgaaccatgaaaaagatccaaaatataacattgtagatcatcgaccgtatacttgatccacttctcatcaatgtta |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7904899 |
ctgagaatggtgcaaagatttttgtgaaccatgaaaaagatccaaaatataacattgtagatcatcgaccgtatacttgatccacttctcatcaatgtta |
7904998 |
T |
 |
| Q |
108 |
gacgagtttctacctgtataacttcggtaagcaggagtaactttctgagaaaccgatatttgtaggtcttcgcgaagttctttatcaggtacactccacc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7904999 |
gacgagtttctacctgtataacttcggtaagcaggaatcaatttctgagaaaccgatatttgtaggtcttcgcgaagttctttatcaggtacactccacc |
7905098 |
T |
 |
| Q |
208 |
ccg |
210 |
Q |
| |
|
||| |
|
|
| T |
7905099 |
ccg |
7905101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University