View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5429_high_1 (Length: 542)
Name: NF5429_high_1
Description: NF5429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5429_high_1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 165; Significance: 5e-88; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 165; E-Value: 5e-88
Query Start/End: Original strand, 1 - 169
Target Start/End: Original strand, 10367818 - 10367986
Alignment:
| Q |
1 |
tatcccttacccttaacccaacttcagggcgcggttggagcggcatctttggactcgaaggaggactgttgagtttgttaactagaagtttgaagcacgg |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10367818 |
tatcccttaccctcaacccaacttcagggcgcggttggagcggcatctttggactcgaaggaggactgttgagtttgttaactagaagtttgaagcacgg |
10367917 |
T |
|
| Q |
101 |
tatcaacgtcaggtaaagacttgccaaaataaaaggtgacgcggctagccaccctaatagctgaaagag |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10367918 |
tatcaacgtcaggtaaagacttgccaaaataaaaggtgacgcggctagccaccctaatagctgaaagag |
10367986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 136; E-Value: 1e-70
Query Start/End: Original strand, 379 - 525
Target Start/End: Original strand, 10368571 - 10368715
Alignment:
| Q |
379 |
cataaacggttaatactttacattcatatatatatttagtaaactcctaattcagaataatcaaatcacatatatggttttatggcatgagctacctacc |
478 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
10368571 |
cataaacggttaatactttacattcatatatatatttagtaaactcctaattcagaataatcaaatcacatat--ggttttatggcatgagctacctacc |
10368668 |
T |
|
| Q |
479 |
gcattggcaatgcttagtaggagttcagttgaagcttgaccagtaat |
525 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10368669 |
gcattggcaatgcttagtaggagttcagttgaagcttgaccagtaat |
10368715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University