View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5429_high_4 (Length: 292)
Name: NF5429_high_4
Description: NF5429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5429_high_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 116; Significance: 5e-59; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 1 - 120
Target Start/End: Original strand, 36915585 - 36915704
Alignment:
| Q |
1 |
cagatctcgaacttgacgacattgatggtggtgttgatgaacaagctagaacaacatttgatttggggaagaaaggaagattttcagatagtgattaatt |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36915585 |
cagatctcgatcttgacgacattgatggtggtgttgatgaacaagctagaacaacatttgatttggggaagaaaggaagattttcagatagtgattaatt |
36915684 |
T |
|
| Q |
101 |
aggtagttgggattttgaag |
120 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
36915685 |
aggtagttgggattttgaag |
36915704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 161 - 272
Target Start/End: Original strand, 36915752 - 36915863
Alignment:
| Q |
161 |
tagtttgtacattgtaggattatattagttgctggtattatgattattgggcttgttgatgtggccatgcgtctatgatttctagggcatatatattaat |
260 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36915752 |
tagtttgtacattgtaggtttatattagttgctggtattatgattattgggcttgttgatgtggccatgcgtctatgatttctagggcatatatattaat |
36915851 |
T |
|
| Q |
261 |
ttctctgtttat |
272 |
Q |
| |
|
|||||||||||| |
|
|
| T |
36915852 |
ttctctgtttat |
36915863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University