View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5429_low_3 (Length: 313)
Name: NF5429_low_3
Description: NF5429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5429_low_3 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 110 - 297
Target Start/End: Original strand, 28896449 - 28896636
Alignment:
| Q |
110 |
ctgaagtatatggaaggcaagacatgaaagctcttttagagtaagtaaaattgtgtagataagatagttgaggaggcgaacttgtcctcttggaattggt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28896449 |
ctgaagtatatggaaggcaagacatgaaagctcttttagagtaagtaaaattgtgtagataagatagttgaggaggcgaacttgtcctcttggaattggt |
28896548 |
T |
 |
| Q |
210 |
tgagtattaaatcgaataaccttgattataacatatcacaatggtgcctgaatccaatggcttgccttagtctctcgcgacaagattt |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
28896549 |
tgagtattaaatcgaataaccttgattataacatatcacaatggtgcctgaatccaatggcttgccttagtctgtcgcgacaagattt |
28896636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University