View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5430_high_2 (Length: 250)
Name: NF5430_high_2
Description: NF5430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5430_high_2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 16 - 238
Target Start/End: Original strand, 26855905 - 26856127
Alignment:
| Q |
16 |
attagtatttgtgttggcactatgtttaagaaaatccatggacaaagaattggccacaatttcatcaatgggaatattagcagggtccataggaacaaca |
115 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
26855905 |
attagtatttgtattggcactatgtttaagaaaatccatggacaaagaattagccacaatttcatcaatgggagtattagcagggtacataggaacaaca |
26856004 |
T |
|
| Q |
116 |
gcatttcctgttctattttgtattctcaaagagcttaaccttataaactcagatgtcggacgacttgcattatcgaccgcattaatcggcgatgcatgtg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| || |
|
|
| T |
26856005 |
gcatttcctgttctattttgtattctcaaagagcttaaccttataaactcagatgtcggacgacttgcattatcgaccgcgttaatcggcgatgcatttg |
26856104 |
T |
|
| Q |
216 |
gaattggcggtgttttagcattt |
238 |
Q |
| |
|
||||||| ||||||||||||||| |
|
|
| T |
26856105 |
gaattggtggtgttttagcattt |
26856127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University