View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5430_low_4 (Length: 236)
Name: NF5430_low_4
Description: NF5430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5430_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 26856527 - 26856746
Alignment:
| Q |
1 |
cctttgtttctcttgattttgactggatactcaaccaaattctttgttacttggttggctacaatgtattggcgtatgccattcagagatggactaacct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| || | |
|
|
| T |
26856527 |
cctttgtttctcttgattttgactggatactcatccaaattctttgttacttggttggctgcaatgtattggcgtatgccattcagagatggactcacat |
26856626 |
T |
 |
| Q |
101 |
ttagcctcattatgagcttaagaggacaatgtgaacttatcatgcttgtgcatttcatggacaaaagggtaagtaagttccaatctaatttgtacttaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
26856627 |
ttagcctcattatgagcttaagaggacaatgtgaacttatcatgtttgtgcatttcatggacaaaagggtaagtaagttccaatcaaatttgtacttaga |
26856726 |
T |
 |
| Q |
201 |
atttagttcaataactaaaa |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
26856727 |
atttagttcaataactaaaa |
26856746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University