View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5430_low_5 (Length: 228)
Name: NF5430_low_5
Description: NF5430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5430_low_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 119; Significance: 6e-61; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 1 - 127
Target Start/End: Complemental strand, 17355964 - 17355838
Alignment:
| Q |
1 |
ttcacgacaattgatcaagaaatgaaagatatgacccacaagatttgtaatggtagccataccaatacaagatcttgttctttcttaaaagaaaatcaag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17355964 |
ttcacgacaattgatcaagaaatgaaagataagacccataagatttgtaatggtagccataccaatacaagatcttgttctttcttaaaagaaaatcaag |
17355865 |
T |
|
| Q |
101 |
aaacataagcccaaaaaacaaatatga |
127 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
17355864 |
aaacataagcccaaaaaacaaatatga |
17355838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 225
Target Start/End: Complemental strand, 17355818 - 17355779
Alignment:
| Q |
186 |
taagatgatgaaaatatgaagaagaaggggttcatgatga |
225 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
17355818 |
taagatgatgaaaatatgaagaagaagaggttcatgatga |
17355779 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University