View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5431_low_3 (Length: 377)
Name: NF5431_low_3
Description: NF5431
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5431_low_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 321; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 321; E-Value: 0
Query Start/End: Original strand, 1 - 361
Target Start/End: Complemental strand, 38029003 - 38028643
Alignment:
| Q |
1 |
acaggttgtcgggtgggcgggtcattacataaaatgtgtttttcttatgtaacatcatagcctaatcaacaaccgataatgttaatcatgatcttctcgc |
100 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38029003 |
acaggttgtcaggtgggcgggtcgttacataaaatgcgtttttcttatgtaacatcacagcctaatcaacaaccgataatgttaatcatgatattctcgc |
38028904 |
T |
 |
| Q |
101 |
atccaaccccccgcaacaaaataacaatgtcttgccttttatgggcgttgaatccggtatctaggagataaactgcattttgaactcccagtacctattg |
200 |
Q |
| |
|
||||| ||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
38028903 |
atccatccccccgcaacaaaataacgatgttttgccttttatgggcgttgaatccggtatctaggagataaactgcattttgaactcccactacctattg |
38028804 |
T |
 |
| Q |
201 |
agacaactcaatttggtagttaagtaaacataatatttatttcataggtattggattcaactcaaatggaaggcaaacccttactaaattttccttgggg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38028803 |
agacaactcaatttggtagttaagtaaacataatatttatttcataggtattggattcaactcaaatggaaggcaaacccttactaaattttccttgggg |
38028704 |
T |
 |
| Q |
301 |
taaaaaagcatgtgaacattagggttgatttccgtgtgaggccggtttgttatataaaaac |
361 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
38028703 |
taaaaaagcatgtgaacattagggttgatttctgtgtgaggccggtttgttatataaaaac |
38028643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University