View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5432_high_4 (Length: 251)
Name: NF5432_high_4
Description: NF5432
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5432_high_4 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 2 - 251
Target Start/End: Complemental strand, 2963760 - 2963512
Alignment:
| Q |
2 |
ggatgtccaagaatatggctttggctcttagaggaccactaaatttgcccaatatttaatcgtccacaaccattcaacttaaaagctacaaatcattcca |
101 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2963760 |
ggatatcctagaatatggctttggctcttagaggaccactaaatttgcccaatatttaatcgtccacaaccattcaacttaaaagctacaaatcattcct |
2963661 |
T |
|
| Q |
102 |
ggaccatcttcaaaagcaagatcaccaaatgtagcccccaaataaaaagataactctctaacccannnnnnnnnatccggcagctgtttagttagtagca |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
2963660 |
ggaccatcttcaaaagcaagatcaccaaatgtagcccccaaataaaaagacaactttctaaccca-ttttttttatccggcagctggttagttagtagca |
2963562 |
T |
|
| Q |
202 |
tgaagcgagattttaaggtgcctcttttaattcgatcgtcggctttttat |
251 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2963561 |
tgaagcgagattttaaggtgtctcttttaattcgatcgtcggctttttat |
2963512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University